MCGB B2DSC Faidx TNAC-marker MGOC TR PP-Locator
 

Your job id is: t662ab059. 11 sequences were blasted against Triticum_aestivum-iwgsc_refseqv1_0 genome.

Note: Job will be stored only 7 days.

Parameters used to filter blast results:

pident = 85, qcovhsp = 80, Sequence(s) just filtered = All of them


Draw picture(s) using the data left.

Size
top px    bottom px    left px    right px
px
left px    tick-length px    length px    width px
left px    right px    tick-length px
left px    right px    width px    cap radius px
px
tick label px    Mbp px    chromosome name px
width px (0 means will not plot bars.)
width px
Offset
x px    y em
x px    y em
y em
y em
Color
Black White
Background    Foreground
fill    border
HSP per Mbp  Value < 0 will not be plot.
HSP per Mbp  Value ≥ 100 will in this color.
Id: CCS1
Description: Oligo-CCS1; Centromeric satellite repeats Cereal centromeric sequence
Sequence: CCGTTTGATAGAGGCAAAGGTGTCCCGTCTTTTGATGAGA
pident = 85, qcovehsp = 80
    Note:
  1. Mouseover barcodes and bars to get information.
    Note:
  1. Click rectangulars with less than 100 repeats will show sequences.
  2. Mouseover rectangulars will show start and end.